RIPK1 (NM_003804.6) sequence variants
(RIP, RIP1, IMD57, RIP-1)

Editor(s): Qing ZHOU   

Home Page Variants list Sequences Download Useful links Statistics Build your graph Contact Submit a novel sequence variant Submit a novel complex allele

🔎

Total current number of sequence variants for RIPK1 : 13

*Name as first published or submitted to Infevers. May be different from the HGVS edited protein and sequence names.

** If you have new data: please send us a re-evaluation proposal here

HGVS sequence name
HGVS protein name
Usual name*
Classification**
Status**
Simple variant
Complex alleles
exon 8
c.973T>C
p.(Cys325Arg)
C325R
Uncertain significance (VUS)To be validated
 2020-06-05
intron 4
c.460-133_689-244del
p.?
DELexon5
PathogenicTo be validated
 2020-01-31
exon 5
c.688_688+20delAGTAAGGCATTACTTACTTTC
p.?
c.688_688+20del
PathogenicTo be validated
 2020-01-30
exon 11
c.1844T>C
p.(Ile615Thr)
I615T
PathogenicTo be validated
 2020-01-29
exon 11
c.1934C>T
p.(Thr645Met)
T645M
PathogenicTo be validated
 2020-01-29
exon 9
c.1278C>A
p.(Tyr426*)
Y426*
PathogenicTo be validated
 2020-01-29
exon 8
c.954delG
p.(Met318Ilefs*194)
M318fs
PathogenicTo be validated
 2020-01-29
exon 11
c.1802G>A
p.(Cys601Tyr)
C601Y
PathogenicTo be validated
 2020-01-29
exon 7
c.867_870delTTTA
p.(Tyr289*)
Y289*
PathogenicTo be validated
 2020-01-29
exon 8
c.971A>T
p.(Asp324Val)
D324V
PathogenicTo be validated
 2020-01-27
exon 8
c.970G>C
p.(Asp324His)
D324H
PathogenicTo be validated
 2020-01-27
exon 8
c.970G>A
p.(Asp324Asn)
D324N
PathogenicTo be validated
 2020-01-27
exon 8
c.970G>T
p.(Asp324Tyr)
D324Y
PathogenicTo be validated
 2020-01-27