RIPK1 (NM_003804.6) sequence variants
(RIP, RIP1, IMD57, RIP-1)

Editor(s): Qing ZHOU   

Home Page Variants list Sequences Download Useful links Statistics Build your graph Contact Submit a novel sequence variant Submit a novel complex allele

🔎

Total current number of sequence variants for RIPK1 : 13

*Name as first published or submitted to Infevers. May be different from the HGVS edited protein and sequence names.

** If you have new data: please send us a re-evaluation proposal here

HGVS sequence name
HGVS protein name
Usual name*
Classification**
Status**
Simple variant
Complex alleles
intron 4
c.460-133_689-244del
p.?
DELexon5
PathogenicTo be validated
 2020-01-31
exon 5
c.688_688+20delAGTAAGGCATTACTTACTTTC
p.?
c.688_688+20del
PathogenicTo be validated
 2020-01-30
exon 7
c.867_870delTTTA
p.Tyr289*
Y289*
PathogenicTo be validated
 2020-01-29
exon 8
c.954delG
p.Met318Ilefs*194
M318fs
PathogenicTo be validated
 2020-01-29
exon 8
c.970G>C
p.Asp324His
D324H
PathogenicTo be validated
 2020-01-27
exon 8
c.970G>A
p.Asp324Asn
D324N
PathogenicTo be validated
 2020-01-27
exon 8
c.970G>T
p.Asp324Tyr
D324Y
PathogenicTo be validated
 2020-01-27
exon 8
c.971A>T
p.Asp324Val
D324V
PathogenicTo be validated
 2020-01-27
exon 8
c.973T>C
p.(Cys325Arg)
C325R
Uncertain significance (VUS)To be validated
 2020-06-05
exon 9
c.1278C>A
p.Tyr426*
Y426*
PathogenicTo be validated
 2020-01-29
exon 11
c.1802G>A
p.Cys601Tyr
C601Y
PathogenicTo be validated
 2020-01-29
exon 11
c.1844T>C
p.Ile615Thr
I615T
PathogenicTo be validated
 2020-01-29
exon 11
c.1934C>T
p.Thr645Met
T645M
PathogenicTo be validated
 2020-01-29