T356M |
| Detail variant |
| Gene |
MVK |
| NM number |
NM_000431.4 |
| ENST number |
ENST00000228510.8
|
| Location in the gene |
exon 11 |
Usual name
Name as first published or submitted to Infevers.
May be different from the HGVS edited protein and sequence names.
|
T356M |
| HGVS protein name |
p.(Thr356Met) |
| HGVS sequence name |
c.1067C>T |
| rs Number |
rs104895342 |
| Sequence |
cDNA: CAGAAGTGGAGGCCACGAAGCAGGCCCTGAC |
| Alteration |
Substitution |
|
N base(s)
|
1
|
|
Base substituded
|
C>T |
Pathogenicity score/Status
If you have new data: please send us a re-evaluation proposal here |
Uncertain significance (VUS)/VALIDATED
|
Allele Frequencies
gnomAD v2.1.1 via Annovar |
See data
| |
African |
Ashkenazi Jewish |
East Asian |
European
(Finnish) |
European
(non-Finnish) |
Latino |
South Asian |
Other |
Total |
| Exome |
0 |
0 |
0 |
0 |
0.0002 |
0.0001 |
3.267e-05 |
0.0002 |
0.0001 |
| Genome |
0 |
0 |
0 |
0 |
0.0001 |
0 |
. |
0 |
6.374e-05 |
|
| Using In silico prediction? |
Unknown
|
| Functional tests |
No |
| Functional approach |
Not applicable
|
| Consequence |
Not applicable |
Phenotype/Genotype
a variant observed in symptomatic subjects does not imply its causal role |
| Disease related symptoms in this patient |
Unknown |
|
Associated phenotype in this patient
|
Unknown |
| Zygosity in this patient |
Unknown
|
| Inheritance in this patient |
Unknown
|
| Country of origin / Ancestry |
Italy / Unknown |
| Contribution |
| Reference |
Initial publication:
MVK mutations and associated clinical features in Italian patients affected with autoinflammatory disorders and recurrent fever.
D'Osualdo A & al. Eur J Hum Genet, 2005 Mar |
| Other publications via LitVar |
None |
| Contributed by (Input date) |
Andrea D'OSUALDO (2004-12-16)
|
| Comment |
- |
| Direct link |
Copy this link |
| Last update |
2004-12-16 |
