2024-03-29 PSTPIP1 - NM_003978.5 Location Usual name protein name Sequence change Alteration N base(s) Base substituted Classification Status Using In silico prediction? Fonctional test Functional approach? Consequence Techniques used Disease related symptoms Associated phenotype Zygosity in this patient Inheritance in this patient Ancestry/origin Comment Input date References Other PMID 5UT -282G>T p.? c.-282G>T substitution 1 G>T Uncertain significance (VUS) UNKNOWN NO Sequencing NGS Unknown Vasculitis Unknown Unknown France/ 2019-05-13 Maria A Rittore C Imbert-Bouteille M Sarrabay G Touitou I Personal communication 5UT c.262G>A p.? c.-187G>A substitution 1 G>A Not classified UNKNOWN UNKNOWN Sequencing NGS Symptomatic Undefined-AID FMF-like Unknown Unknown Turkey/ According to the article : NM_003978.4:c.-187G>A XR_931936.2:n.262G>A rs534702768 2020-04-28 Publication (PubMed PMID): 32199921 Exon 1 M2T p.(Met2Thr) c.5T>C substitution 1 T>C Likely benign VALIDATED UNKNOWN NO ARMS Symptomatic Recurrent Fever The patient is a 56-years old female who has had episodes of periodic fever and joint swelling for 3 years. Unknown Unknown Japan/Asian She also has L110P/E148Q mutations in MEFV gene and 14 bps deletion in intron 14 of PSTPIP1 gene (c.1120-44_1120-31del). Though this mutation was not detected in 42 healthy controls, her healthy younger sister (53 years old) and her healthy mother (81 years old) also have this mutation. The mutation seems less likely to contribute to the devlopment of periodic fever. 2013-09-06 Takabe K Adachi Y Saito H Yamashita T Wakai Y Saito K Shinohara Y. Congress abstract:the autoinflammation 2013 conference, Lausanne, Switerland, 22-26 May 2013 Exon 2 T20M p.(Thr20Met) c.59C>T substitution 1 C>T Uncertain significance (VUS) UNKNOWN NO Sequencing NGS Symptomatic Non symptomatic Undefined-AID Unknown Unknown France/Mediterranean In another individual, inherited from an asymptomatic parent. 2019-05-13 Lamireau T Mechin D Sarrabay G Touitou I Personal communication Exon 2 K34T p.(Lys34Thr) c.101A>C substitution 1 A>C Uncertain significance (VUS) UNKNOWN UNKNOWN Sequencing NGS Symptomatic Undefined-AID Unknown Unknown Japan/ No clinical informations 2019-10-02 Publication (PubMed PMID): 28956000 Intron 2 c.137+47G>C p.? c.137+47G>C substitution 1 G>C Benign VALIDATED UNKNOWN NO Sequencing Sanger Symptomatic Non symptomatic UNKNOWN Unknown Unknown France/Caucasian 2011-12-22 Dumont B Fabre A Touitou I Personal communication Exon 3 A49V p.(Ala49Val) c.146C>T substitution 1 C>T Uncertain significance (VUS) UNKNOWN NO Sequencing NGS Symptomatic Undefined-AID Vasculitis Unknown Unknown France/ 2019-05-13 Geneviève D Rittore C Imbert-Bouteille M Sarrabay G Touitou I Personal communication Exon 3 E51D p.(Glu51Asp) c.153G>T substitution 1 G>T Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ 2019-08-21 Publication (PubMed PMID): 27184502 Exon 3 R52Q p.(Arg52Gln) c.155G>A substitution 1 G>A Uncertain significance (VUS) VALIDATED UNKNOWN YES Unknown Unknown Sequencing Sanger dHPLC Symptomatic Non symptomatic Pyoderma gangrenosum Unknown Unknown / This variant does not map within any of the key functional domains of CD2BP1 and does not alter transcript splicing. Although this variant was only present in 1 of 600 ethnically matched healthy controls, it is predicted to be biologically silent by an in silico algorithm (PolyPhen) 2012-03-02 Publication (PubMed PMID): 15102098 Exon 3 L57R p.(Leu57Arg) c.170T>G substitution 1 T>G Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ 2019-08-21 Publication (PubMed PMID): 27184502 Exon 3 R62W p.(Arg62Trp) c.184C>T substitution 1 C>T Uncertain significance (VUS) UNKNOWN NO Sequencing NGS Symptomatic Undefined-AID Unknown Unknown France/ 2019-05-13 Attout H Dumont B Sarrabay G Touitou I Personal communication Exon 3 A64T p.(Ala64Thr) c.190G>A substitution 1 G>A Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ 2019-08-21 Publication (PubMed PMID): 27184502 Exon 3 T68M p.(Thr68Met) c.203C>T substitution 1 C>T Not classified UNKNOWN UNKNOWN Sequencing Sanger Sequencing NGS Symptomatic Behçet's disease Unknown Unknown Spain/Caucasian 2017-01-18 Publication (PubMed PMID): 28814775 Exon 5 E110D p.(Glu110Asp) c.330G>C substitution 1 G>C Uncertain significance (VUS) YES NO Sequencing Sanger Sequencing NGS Symptomatic UNKNOWN Unknown Unknown Italy/Caucasian 2019-07-16 Grossi A Ceccherini I Personal communication Exon 6 Y119C p.(Tyr119Cys) c.356A>G substitution 1 A>G Not classified UNKNOWN NO Sequencing NGS Symptomatic PAPA Heterozygous Unknown China/Asian 2022-02-21 Publication (PubMed PMID): 34745107 Exon 6 V122I p.(Val122Ile) c.364G>A substitution 1 G>A Likely benign VALIDATED UNKNOWN NO Sequencing Sanger Sequencing NGS Symptomatic Behçet's disease Unknown Unknown Spain/Caucasian 2016-11-23 Publication (PubMed PMID): 28814775 Exon 6 M123_L416delinsT p.(Met123_Leu416delinsThr) c.368_378delinsCTTAGCCCTCT delins 11 deleted/11 inserted TGGACCGGGTC / CTTAGCCCTCT Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ strangly, several other indel PSTPIP1 variants were described in this patient 2019-08-21 Publication (PubMed PMID): 27184502 Exon 6 M123_K128delinsTMLLSQ p.(Met123_Lys128delinsThrMetLeuLeuSerGln) c.368_382delinsCGATGCTGCTTAGCC delins 15 deleted/15 inserted TGGACCGGGTCCAGA / CGATGCTGCTTAGCC Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ strangly, several other indel PSTPIP1 variants were described in this patient 2019-08-21 Publication (PubMed PMID): 27184502 Exon 6 D124_K128delinsGMLLS p.(Asp124_Lys128delinsGlyMetLeuLeuSer) c.371_384delinsGGATGCTGCTTAGC delins 14 deleted/14 inserted ACCGGGTCCAGAAG / GGATGCTGCTTAGC Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ 2019-08-21 Publication (PubMed PMID): 27184502 Exon 6 L133_K136delinsPPDP) p.(Leu133_Lys136delinsProProAspPro) c.398_407delinsCCCCAGACCC delins 10 deleted/10 inserted TCTACAAGAA / CCCCAGACCC Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ strangly, several other indel PSTPIP1 variants were described in this patient 2019-08-21 Publication (PubMed PMID): 27184502 Exon 8 G543A p.(Lys181=) c.543G>A substitution 1 G>A Likely benign VALIDATED UNKNOWN NO Sequencing Sanger Symptomatic Non symptomatic The sequence and/or protein name of this variant has been edited as compared to that in the initial publication Unknown Unknown United states/Caucasian 2012-06-13 Publication (PubMed PMID): 15102098 Exon 9 R202W p.(Arg202Trp) c.604C>T substitution 1 C>T Uncertain significance (VUS) YES NO Sequencing Sanger Sequencing NGS Symptomatic UNKNOWN Unknown Unknown Russian federation/Caucasian 2019-07-16 Grossi A Ceccherini I Personal communication Exon 9 R210W p.(Arg210Trp) c.628C>T substitution 1 C>T Uncertain significance (VUS) YES UNKNOWN Sequencing NGS Symptomatic Acne inversa Heterozygous Unknown Cameroon/African 2022-09-21 Fayand A Rittore C Sabbagh Q Boursier G Personal communication Exon 10 c.C850T: p.Q284X p.(Gln219*) c.655C>T substitution 1 C>T Uncertain significance (VUS) YES NO Sequencing NGS Unknown UNKNOWN Heterozygous Unknown India/ The HGVS name of this variant has been changed to comply with the NM reference used in Infevers 2022-02-21 Publication (PubMed PMID): 34905135 Exon 10 Q219H p.(Gln219His) c.657A>C substitution 1 A>C Not classified UNKNOWN YES Unknown Sequencing Sanger Sequencing NGS Symptomatic NLRP3-AID-mild (FCAS) Atypical FCAS Unknown Unknown Spain/Caucasian 2017-04-03 Montes-Cano Marco-Antonio Manuel Prados Castaño Personal communication Exon 10 E220_I226delinsDRQFHPG p.(Glu220_Ile226delinsAspArgGlnPheHisProGly) c.660_678delinsTCGACAGTTTCATCCAGGC delins 19 deleted/19 inserted GTTTGACCGGCTGACCATT / TCGACAGTTTCATCCAGGC Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ strangly, several other indel PSTPIP1 variants were described in this patient 2019-08-21 Publication (PubMed PMID): 27184502 Exon 10 D222_L416delinsSTRKCG) p.(Asp222_Leu416delinsSerThrArgLysCysGly) c.664_684delinsTCTACGAGGAAGTGCGGCTGA delins 21 deleted/21 inserted GACCGGCTGACCATTCTCCGC / TCTACGAGGAAGTGCGGCTGA Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ strangly, several other indel PSTPIP1 variants were described in this patient 2019-08-21 Publication (PubMed PMID): 27184502 Exon 10 R228C p.(Arg228Cys) c.682C>T substitution 1 C>T Not classified UNKNOWN NO Sequencing NGS Symptomatic Undefined-AID Unknown Unknown / 2019-05-13 Publication (PubMed PMID): 30783801 36692132 Exon 10 A230T p.(Ala230Thr) c.688G>A substitution 1 G>A Pathogenic VALIDATED UNKNOWN NO Heteroduplex Sequencing Sanger Symptomatic PAPA Unknown Unknown United states/Caucasian This change abrogates binding to the PTP PEST protein in yeast two hybrid experiments. 2003-04-18 Publication (PubMed PMID): 11971877 Exon 10 N236K p.(Asn236Lys) c.708C>A substitution 1 C>A Likely pathogenic YES NO Sequencing NGS Symptomatic PAPA Heterozygous De novo China/Asian skin rash, arthritis, persistent systemic inflammation, hepatosplenomegaly, pancytopenia, and growth retardation, which matched the typical phenotypes of PAMI. 2021-03-19 Benke Paul J Boursier G Terre A Personal communication 33042144 Exon 10 Q237_M240delinsRHRQ) p.(Gln237_Met240delinsArgHisArgGln) c.710_719delinsGACATCGACA delins 10 deleted/10 inserted AGCTCTCCAT / GACATCGACA Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ strangly, several other indel PSTPIP1 variants were described in this patient 2019-08-21 Publication (PubMed PMID): 27184502 Exon 10 S239P p.(Ser239Pro) c.715T>C substitution 1 T>C Uncertain significance (VUS) YES NO Sequencing NGS Symptomatic Undefined-AID Heterozygous Unknown France/Caucasian chilblain lesions 2022-03-01 Vautier M Guillaume-Jugnot P Rittore C Boursier G Personal communication Exon 10 Q241R p.(Gln241Arg) c.722A>G substitution 1 A>G Likely pathogenic UNKNOWN UNKNOWN Sequencing NGS Symptomatic PSTPIP1-associated AID Unknown Unknown France/African AA amyloidosis, genital pustulosis since infancy and severe inflammatory syndrome 2020-07-09 Georgin-Lavialle S. Rittore C. Boursier G. Touitou I. Personal communication Exon 10 D246N p.(Asp246Asn) c.736G>A substitution 1 G>A Likely pathogenic VALIDATED UNKNOWN NO Sequencing Sanger Symptomatic PAPA Unknown Unknown Jordan/Arab Found de novo 2013-07-08 Publication (PubMed PMID): 24960411 Intron 10 c.741+27G>T p.? c.741+27G>T substitution 1 G>T Likely benign VALIDATED UNKNOWN UNKNOWN Sequencing Sanger Unknown UNKNOWN Unknown Unknown Italy/Caucasian 2013-09-12 lucherini OM Vitale A Magnotti F Guerrini S Caso F Brizi G Galeazzi M Cantarini L Personal communication Intron 10 c.741+33_741+34insGT p.? c.741+32_741+33dup duplication 2 GT Likely benign VALIDATED UNKNOWN NO Heteroduplex Sequencing Sanger Non symptomatic NO Unknown Unknown Yugoslavia/ The sequence and/or protein name of this variant has been edited as compared to that submitted (usual name) to comply with the current nomenclature 2006-04-24 Sanchez E Touitou I Personal communication Exon 11 E250Q p.(Glu250Gln) c.748G>C substitution 1 G>C Pathogenic VALIDATED UNKNOWN NO Heteroduplex Sequencing Sanger Symptomatic PAPA Unknown Unknown United states/Caucasian This change abrogates binding to PTP PEST in yeast two hybrid experiments 2003-04-18 Publication (PubMed PMID): 11971877 33587775 Exon 11 E250K p.(Glu250Lys) c.748G>A substitution 1 G>A Pathogenic VALIDATED UNKNOWN UNKNOWN Sequencing Sanger Symptomatic PAPA Unknown Unknown United states/Caucasian 2007-01-10 Aksentijevich I Personal communication 35438416 Exon 11 T255M p.(Thr255Met) c.764C>T substitution 1 C>T Not classified UNKNOWN NO Sequencing NGS Symptomatic PAPA Unknown Unknown / 2021-08-26 Publication (PubMed PMID): 34273117 Exon 11 E257K p.(Glu257Lys) c.769G>A substitution 1 G>A Likely pathogenic VALIDATED UNKNOWN NO Sequencing Sanger Symptomatic PAPA Unknown Unknown United states/Mexican 2013-07-24 I. Aksentijevich Personal communication Exon 11 E256G p.(Glu257Gly) c.770A>G substitution 1 A>G Likely pathogenic PROVISIONAL UNKNOWN UNKNOWN Sequencing Sanger Unknown PAPA Unknown Unknown / The protein name has changed compared with the initial publication to comply with the HGVS nomenclature 2013-09-17 Publication (PubMed PMID): 22377804 Exon 11 G258R p.(Gly258Arg) c.772_774delinsAGG delins 3 deleted/3 inserted GGC / AGG Uncertain significance (VUS) UNKNOWN UNKNOWN Sequencing NGS Symptomatic Undefined-AID Unknown Unknown Italy/ Recurrent fever episodes, every 15-20 days, with exudative pharyngitis, cervical lymphadenopathy, abdominal pain and arthralgia. Partial response to colchicine 2019-10-02 Publication (PubMed PMID): 31325311 Exon 11 G258S p.Gly258Ser c.772G>A substitution 1 G>A Uncertain significance (VUS) UNKNOWN UNKNOWN Sequencing NGS Symptomatic Undefined-AID Heterozygous Unknown Canada/Caucasian 2023-08-31 JACQUEMONT ML Personal communication Exon 11 G258A p.(Gly258Ala) c.773G>C substitution 1 G>C Likely benign PROVISIONAL UNKNOWN NO Sequencing Sanger Symptomatic UNKNOWN Unknown Unknown United states/Caucasian 2012-06-12 Publication (PubMed PMID): 21790734 Exon 11 D266N p.(Asp266Asn) c.796G>A substitution 1 G>A Uncertain significance (VUS) PROVISIONAL UNKNOWN NO Sequencing Sanger Symptomatic PAPA Unknown Unknown Spain/ 2006-05-22 Arostegui JI Cid MC Yague J Personal communication Exon 11 T274M p.(Thr274Met) c.821C>T substitution 1 C>T Uncertain significance (VUS) UNKNOWN YES Culture studies less responsive effect to T-cell activation through altered F-actin polymerization Unknown Symptomatic Otulin-AID Common Variable Immune Deficiency (CVID) Unknown Unknown Czech republic/ According to the publication : CVID presenting with aberrant T-cell compartments but with no classical PAPA or FMF syndrome 2019-10-02 Publication (PubMed PMID): 29432774 Exon 11 E277D p.(Glu277Asp) c.831G>T substitution 1 G>T Likely benign PROVISIONAL UNKNOWN NO Sequencing Sanger Symptomatic PAPASH Unknown Unknown Moldova, republic of/ 2013-06-24 Publication (PubMed PMID): 23571383 Exon 12 D289H p.(Asp289His) c.865G>C substitution 1 G>C Uncertain significance (VUS) VALIDATED UNKNOWN NO Sequencing Sanger Sequencing NGS Symptomatic Behçet's disease Unknown Unknown Spain/Caucasian 2016-11-23 Publication (PubMed PMID): 28814775 Exon 12 P299S p.(Pro299Ser) c.895C>T substitution 1 C>T Uncertain significance (VUS) YES UNKNOWN Sequencing NGS Symptomatic Undefined-AID Heterozygous Unknown France/Mediterranean 2023-08-01 Quartier P Rittore C Fabre A Boursier G Personal communication Exon 12 C915T p.(Cys305=) c.915C>T substitution 1 C>T Benign VALIDATED UNKNOWN NO Sequencing Sanger Symptomatic Non symptomatic NO Unknown Unknown United states/Caucasian The sequence and/or protein name of this variant has been edited as compared to that in the initial publication 2012-06-13 Publication (PubMed PMID): 15102098 Exon 13 S323L p.(Ser323Leu) c.968C>T substitution 1 C>T Uncertain significance (VUS) YES NO Sequencing Sanger Sequencing NGS Symptomatic UNKNOWN Unknown Unknown Italy/Caucasian 2019-07-16 Grossi A Ceccherini I Personal communication Intron 13 c.986-33dupA p.? c.986-33dupA duplication 1 A Benign VALIDATED UNKNOWN NO Sequencing Sanger Symptomatic Non symptomatic UNKNOWN Unknown Unknown France/Caucasian 2011-12-22 Dumon B Fabre A Touitou I Personal communication Exon 14 A329V p.(Ala329Val) c.986C>T substitution 1 C>T Uncertain significance (VUS) UNKNOWN NO Sequencing NGS Symptomatic Familial urticaria Unknown Unknown France/ 2019-05-13 Pagnier A Rittore C Sarrabay G Touitou I Personal communication Exon 14 T337Pfs*52 p.(Thr337Profs*52) c.1008_1025delinsTCCCGGGTGGGGGGAGG delins 18 deleted/17 inserted CACCCCCGAGCGGAATGA / TCCCGGGTGGGGGGAGG Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ strangly, several other indel PSTPIP1 variants were described in this patient 2019-08-21 Publication (PubMed PMID): 27184502 Exon 14 P338_A347delinsLSERRVHTS p.(Pro338_Ala347delinsLeuSerGluArgArgValValHisThrSer) c.1013_1039delinsTGAGTGAAAGGAGGGTGGTGCACACAT delins 27 deleted/27 inserted CCGAGCGGAATGAGGGTGTCTACACAG / TGAGTGAAAGGAGGGTGGTGCACACAT Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ strangly, several other indel PSTPIP1 variants were described in this patient 2019-08-21 Publication (PubMed PMID): 27184502 Exon 14 E339_D341delinsGGM p.(Glu339_Asn341delinsGlyGlyMet) c.1016_1023delinsGGGGAATG delins 8 deleted/8 inserted AGCGGAAT / GGGGAATG Uncertain significance (VUS) NO NO Sequencing Sanger Unknown RA Unknown Unknown India/ strangly, several other indel PSTPIP1 variants were described in this patient 2019-08-21 Publication (PubMed PMID): 27184502 Exon 14 Val344Ile p.(Val344Ile) c.1030G>A substitution 1 G>A Uncertain significance (VUS) VALIDATED UNKNOWN YES Unknown Unknown Sequencing Sanger Symptomatic UNKNOWN Unknown Unknown Netherlands/Caucasian 2008-12-01 van Gijn ME Personal communication Exon 14 Y345C p.(Tyr345Cys) c.1034A>G substitution 1 A>G Likely pathogenic NO NO Sequencing Sanger Symptomatic PASH Unknown Unknown Japan/Asian 2019-08-21 Publication (PubMed PMID): 29575118 Exon 14 E352K p.(Glu352Lys) c.1054G>A substitution 1 G>A Not classified NO NO Sequencing NGS Symptomatic Undefined-AID recurrent fever Unknown Unknown Italy/ 2019-07-01 Ceccherini I Personal communication 26386126 Exon 14 E352A p.(Glu352Ala) c.1055A>C substitution 1 A>C Uncertain significance (VUS) YES NO Sequencing NGS Symptomatic Undefined-AID Heterozygous Unknown France/Mediterranean 2023-07-18 Arnold G Rittore C Fabre A Boursier G Personal communication Exon 14 R365W p.(Arg365Trp) c.1093C>T substitution 1 C>T Uncertain significance (VUS) YES NO Sequencing Sanger Sequencing NGS Symptomatic PAPA Unknown Unknown Italy/Caucasian 2019-07-16 Grossi A Ceccherini I Personal communication Exon 14 D369G p.(Asp369Gly) c.1106A>G substitution 1 A>G Uncertain significance (VUS) UNKNOWN UNKNOWN Sequencing NGS Symptomatic Undefined-AID Unknown Unknown Japan/ No clinical informations 2019-10-02 Publication (PubMed PMID): 28956000 Exon 14 A372V p.(Ala372Val) c.1115C>T substitution 1 C>T Not classified UNKNOWN NO Sequencing NGS Symptomatic Recurrent fever Unknown Unknown Egypt/African 2019-05-13 Versini M Rittore C Fabre A Sarrabay G Touitou I Personal communication Intron 14 c.1120-44_1120-31 p.? c.1120-44_1120-31del deletion 14 CTGCAGGCCCTTCC Likely benign VALIDATED UNKNOWN NO Sequencing Sanger Symptomatic Recurrent Fever Unknown Unknown Japan/Asian Three Japanese patients with periodic fever have both this mutation (14 bps deletion of intron 14) of PSTPIP1 gene and L110P/E148Q mutations of MEFV gene. One of these patients also has p.Met2Thr mutation. Though this deletion was detected in 3 of 42 (7.1%) of healthy controls, none of them have both this deletion and L110P/E148Q mutations. 2013-09-06 Takabe K Adachi Y Saito H Yamashita T Wakai Y Saito K Shinohara Y. Congress abstract:the autoinflammation 2013 conference, Lausanne, Switerland, 22-26 May 2013 Intron 14 1120-12T>C p.? c.1120-12T>C substitution 1 T>C Uncertain significance (VUS) UNKNOWN NO Sequencing NGS Symptomatic Vasculitis Unknown Unknown France/ 2019-05-13 Fain O Rittore C Boursier G Sarrabay G Touitou I Personal communication Exon 15 D384G p.(Asp384Gly) c.1151A>G substitution 1 A>G Benign VALIDATED UNKNOWN NO Sequencing Sanger Sequencing NGS Symptomatic Unclassified autoinflammatory syndrome Unknown Unknown France/Caucasian 2015-12-04 Willems M Dumont B Sarrabay G Touitou I Personal communication Exon 15 c.1154T>C p.(Ile385Thr) c.1154T>C substitution 1 T>C Uncertain significance (VUS) UNKNOWN UNKNOWN Sequencing NGS Symptomatic Undefined-AID Unknown Unknown France/ 2019-03-27 Boursier G Vautier M Rittore C Touitou I Personal communication Exon 15 G1179A p.(Glu393=) c.1179G>A substitution 1 G>A Likely benign VALIDATED UNKNOWN NO Sequencing Sanger Symptomatic Non symptomatic NO Unknown Unknown United states/Caucasian The sequence and/or protein name of this variant has been edited as compared to that in the initial publication 2012-06-13 Publication (PubMed PMID): 15102098 Exon 15 G395S p.(Gly395Ser) c.1183G>A substitution 1 G>A Uncertain significance (VUS) UNKNOWN UNKNOWN Sequencing NGS Symptomatic Pyoderma and severe acne Heterozygous Inherited from an asymptomatic parent Cambodia/Asian 2022-06-16 Welfringer A Cenni C Rittore C Boursier G Personal communication Exon 15 G403R p.(Gly403Arg) c.1207G>C substitution 1 G>C Uncertain significance (VUS) VALIDATED UNKNOWN NO Sequencing Sanger Symptomatic PAPA Unknown Unknown / frequency 1 of 8,380 EU chromosomes as given in the exome variant server (EVS) 2015-02-17 Publication (PubMed PMID): 25683018 Exon 15 G403E p.(Gly403Glu) c.1208G>A substitution 1 G>A Uncertain significance (VUS) VALIDATED UNKNOWN NO Sequencing Sanger Sequencing NGS Symptomatic Non symptomatic CAPS Unknown Unknown France/Caucasian This variant is reported in the EXAC database, with allele frequency .0002389 2015-12-23 Retornaz K Dumont B Sarrabay G Touitou I Personal communication Exon 15 R405C p.(Arg405Cys) c.1213C>T substitution 1 C>T Likely benign PROVISIONAL UNKNOWN NO Sequencing Sanger Symptomatic Juvenile Idiopathic Arthritis Unknown Unknown Spain/Caucasian 2014-02-19 Jordi Anton Estibaliz Ruiz-Ortiz Jordi Yague Juan I. Arostegui Personal communication Exon 15 F407L p.(Phe407Leu) c.1221C>A substitution 1 C>A Not classified UNKNOWN NO Unknown Symptomatic hidradenitis suppurativa Unknown Unknown China/Asian 2021-05-27 Publication (PubMed PMID): 33460495 Exon 15 V408I p.(Val408Ile) c.1222G>A substitution 1 G>A Uncertain significance (VUS) YES NO Sequencing Sanger Sequencing NGS Symptomatic UNKNOWN Unknown Unknown Italy/Caucasian 2019-07-16 Grossi A Ceccherini I Personal communication 3UT c.*156_158del p.? c.*156_*158del deletion 3 CCT Benign VALIDATED UNKNOWN NO Sequencing Sanger Symptomatic UNKNOWN Unknown Unknown France/Maghrebian 2012-12-10 Bachelez H Dumont B Touitou I Personal communication